Plotly.NET
Tables
This example shows how to create tables in F#.
Let's first create some data for the purpose of creating example charts:
open Plotly.NET
open Plotly.NET.StyleParam
let table1 =
Chart.Table(
headerValues = [ "<b>RowIndex</b>"; "A"; "simple"; "table" ],
cellsValues = [ [ "0"; "I"; "am"; "a" ]; [ "1"; "little"; "example"; "!" ] ]
)
A little bit of styling:
let table2 =
let header = [ "<b>RowIndex</b>"; "A"; "simple"; "table" ]
let rows = [ [ "0"; "I"; "am"; "a" ]; [ "1"; "little"; "example"; "!" ] ]
Chart.Table(
headerValues = header,
cellsValues = rows,
HeaderAlign = StyleParam.HorizontalAlign.Center,
CellsMultiAlign =
[ StyleParam.HorizontalAlign.Left
StyleParam.HorizontalAlign.Center
StyleParam.HorizontalAlign.Right ],
HeaderFillColor = Color.fromString "#45546a",
CellsFillColor =
Color.fromColors
[ Color.fromString "#deebf7"
Color.fromString "lightgrey"
Color.fromString "#deebf7"
Color.fromString "lightgrey" ],
HeaderHeight = 30,
HeaderOutlineColor = Color.fromString "black",
HeaderOutlineWidth = 2.,
MultiColumnWidth = [ 70.; 50.; 100.; 70. ],
ColumnOrder = [ 1; 2; 3; 4 ]
)
Value dependent cell coloring:
let table3 =
let header2 = [ "Identifier"; "T0"; "T1"; "T2"; "T3" ]
let rowvalues =
[ [ 10001.; 0.2; 2.0; 4.0; 5.0 ]
[ 10002.; 2.1; 2.0; 1.8; 2.1 ]
[ 10003.; 4.5; 3.0; 2.0; 2.5 ]
[ 10004.; 0.0; 0.1; 0.3; 0.2 ]
[ 10005.; 1.0; 1.6; 1.8; 2.2 ]
[ 10006.; 1.0; 0.8; 1.5; 0.7 ]
[ 10007.; 2.0; 2.0; 2.1; 1.9 ] ]
|> Seq.sortBy (fun x -> x.[1])
//map color from value to hex representation
let mapColor min max value =
let proportion = (255. * (value - min) / (max - min)) |> int
Color.fromRGB 255 (255 - proportion) proportion
//Assign a color to every cell seperately. Matrix must be transposed for correct orientation.
let cellcolor =
rowvalues
|> Seq.map (fun row ->
row
|> Seq.mapi (fun index value ->
if index = 0 then
Color.fromString "white"
else
mapColor 0. 5. value))
|> Seq.transpose
|> Seq.map Color.fromColors
|> Color.fromColors
Chart.Table(headerValues = header2, cellsValues = rowvalues, CellsFillColor = cellcolor)
Sequence representation:
let table4 =
let sequence =
[ "ATGAGACGTCGAGACTGATAGACGTCGATAGACGTCGATAGACCG"
"ATAGACTCGTGATAGACGTCGATAGACGTCGATAGAGTATAGACC"
"GTGATAGACGTCGAGAAGACGTCGATAGACGTCGATAGACGTCGA"
"TAGAGATAGACGTCGATAGACCGTATAGAAGACGTCGATAGATAG"
"ACGTCGATAGACCGTAGACGTCGATAGACGTCGATAGACCGT" ]
|> String.concat ""
let elementsPerRow = 60
let headers =
[ 0..elementsPerRow ]
|> Seq.map (fun x -> if x % 10 = 0 && x <> 0 then "|" else "")
let cells =
sequence
|> Seq.chunkBySize elementsPerRow
|> Seq.mapi (fun i x -> Seq.append [ string (i * elementsPerRow) ] (Seq.map string x))
let cellcolors =
cells
|> Seq.map (fun row ->
row
|> Seq.map (fun element ->
match element with
//colors taken from DRuMS
//(http://biomodel.uah.es/en/model4/dna/atgc.htm)
| "A" -> Color.fromString "#5050FF"
| "T" -> Color.fromString "#E6E600"
| "G" -> Color.fromString "#00C000"
| "C" -> Color.fromString "#E00000"
| "U" -> Color.fromString "#B48100"
| _ -> Color.fromString "white"))
|> Seq.transpose
|> Seq.map (fun x -> Seq.append x (seq [ Color.fromString "white" ]))
|> Seq.map Color.fromColors
|> Color.fromColors
let line = Line.init (Width = 0., Color = Color.fromString "white")
let chartwidth = 50 + 10 * elementsPerRow
Chart.Table(
headerValues = headers,
cellsValues = cells,
CellsOutline = line,
HeaderOutline = line,
CellsHeight = 20,
MultiColumnWidth = [ 50.; 10. ],
CellsMultiAlign = [ StyleParam.HorizontalAlign.Right; StyleParam.HorizontalAlign.Center ],
CellsFillColor = cellcolors,
UseDefaults = false
)
|> Chart.withSize (Width = chartwidth)
|> Chart.withTitle "Sequence A"
namespace Plotly
namespace Plotly.NET
module Defaults
from Plotly.NET
<summary> Contains mutable global default values. Changing these values will apply the default values to all consecutive Chart generations. </summary>
<summary> Contains mutable global default values. Changing these values will apply the default values to all consecutive Chart generations. </summary>
val mutable DefaultDisplayOptions: DisplayOptions
Multiple items
type DisplayOptions = inherit DynamicObj new: unit -> DisplayOptions static member addAdditionalHeadTags: additionalHeadTags: XmlNode list -> (DisplayOptions -> DisplayOptions) static member addChartDescription: description: XmlNode list -> (DisplayOptions -> DisplayOptions) static member combine: first: DisplayOptions -> second: DisplayOptions -> DisplayOptions static member getAdditionalHeadTags: displayOpts: DisplayOptions -> XmlNode list static member getChartDescription: displayOpts: DisplayOptions -> XmlNode list static member getDocumentCharset: displayOpts: DisplayOptions -> string static member getDocumentDescription: displayOpts: DisplayOptions -> string static member getDocumentFavicon: displayOpts: DisplayOptions -> XmlNode ...
--------------------
new: unit -> DisplayOptions
type DisplayOptions = inherit DynamicObj new: unit -> DisplayOptions static member addAdditionalHeadTags: additionalHeadTags: XmlNode list -> (DisplayOptions -> DisplayOptions) static member addChartDescription: description: XmlNode list -> (DisplayOptions -> DisplayOptions) static member combine: first: DisplayOptions -> second: DisplayOptions -> DisplayOptions static member getAdditionalHeadTags: displayOpts: DisplayOptions -> XmlNode list static member getChartDescription: displayOpts: DisplayOptions -> XmlNode list static member getDocumentCharset: displayOpts: DisplayOptions -> string static member getDocumentDescription: displayOpts: DisplayOptions -> string static member getDocumentFavicon: displayOpts: DisplayOptions -> XmlNode ...
--------------------
new: unit -> DisplayOptions
static member DisplayOptions.init: [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?DocumentTitle: string * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?DocumentCharset: string * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?DocumentDescription: string * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?DocumentFavicon: Giraffe.ViewEngine.HtmlElements.XmlNode * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?AdditionalHeadTags: Giraffe.ViewEngine.HtmlElements.XmlNode list * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?ChartDescription: Giraffe.ViewEngine.HtmlElements.XmlNode list * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?PlotlyJSReference: PlotlyJSReference -> DisplayOptions
type PlotlyJSReference =
| CDN of string
| Full
| Require of string
| NoReference
<summary> Sets how plotly is referenced in the head of html docs. </summary>
<summary> Sets how plotly is referenced in the head of html docs. </summary>
union case PlotlyJSReference.NoReference: PlotlyJSReference
module StyleParam
from Plotly.NET
val table1: GenericChart
type Chart =
static member AnnotatedHeatmap: zData: #('b seq) seq * annotationText: #(string seq) seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?Name: string * [<Optional; DefaultParameterValue ((null :> obj))>] ?ShowLegend: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?Opacity: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?X: 'd seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiX: 'd seq seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?XGap: int * [<Optional; DefaultParameterValue ((null :> obj))>] ?Y: 'e seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiY: 'e seq seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?YGap: int * [<Optional; DefaultParameterValue ((null :> obj))>] ?Text: 'f * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiText: 'f seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?ColorBar: ColorBar * [<Optional; DefaultParameterValue ((null :> obj))>] ?ColorScale: Colorscale * [<Optional; DefaultParameterValue ((null :> obj))>] ?ShowScale: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?ReverseScale: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?ZSmooth: SmoothAlg * [<Optional; DefaultParameterValue ((null :> obj))>] ?Transpose: bool * [<Optional; DefaultParameterValue ((false :> obj))>] ?UseWebGL: bool * [<Optional; DefaultParameterValue ((false :> obj))>] ?ReverseYAxis: bool * [<Optional; DefaultParameterValue ((true :> obj))>] ?UseDefaults: bool -> GenericChart (requires 'b :> IConvertible and 'd :> IConvertible and 'e :> IConvertible and 'f :> IConvertible) + 1 overload
static member Area: x: #IConvertible seq * y: #IConvertible seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?ShowMarkers: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?Name: string * [<Optional; DefaultParameterValue ((null :> obj))>] ?ShowLegend: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?Opacity: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiOpacity: float seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?Text: 'c * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiText: 'c seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?TextPosition: TextPosition * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiTextPosition: TextPosition seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?MarkerColor: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?MarkerColorScale: Colorscale * [<Optional; DefaultParameterValue ((null :> obj))>] ?MarkerOutline: Line * [<Optional; DefaultParameterValue ((null :> obj))>] ?MarkerSymbol: MarkerSymbol * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiMarkerSymbol: MarkerSymbol seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?Marker: Marker * [<Optional; DefaultParameterValue ((null :> obj))>] ?LineColor: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?LineColorScale: Colorscale * [<Optional; DefaultParameterValue ((null :> obj))>] ?LineWidth: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?LineDash: DrawingStyle * [<Optional; DefaultParameterValue ((null :> obj))>] ?Line: Line * [<Optional; DefaultParameterValue ((null :> obj))>] ?AlignmentGroup: string * [<Optional; DefaultParameterValue ((null :> obj))>] ?OffsetGroup: string * [<Optional; DefaultParameterValue ((null :> obj))>] ?StackGroup: string * [<Optional; DefaultParameterValue ((null :> obj))>] ?Orientation: Orientation * [<Optional; DefaultParameterValue ((null :> obj))>] ?GroupNorm: GroupNorm * [<Optional; DefaultParameterValue ((null :> obj))>] ?FillColor: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?FillPatternShape: PatternShape * [<Optional; DefaultParameterValue ((null :> obj))>] ?FillPattern: Pattern * [<Optional; DefaultParameterValue ((false :> obj))>] ?UseWebGL: bool * [<Optional; DefaultParameterValue ((true :> obj))>] ?UseDefaults: bool -> GenericChart (requires 'c :> IConvertible) + 1 overload
static member Bar: values: #IConvertible seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?Keys: 'b seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiKeys: 'b seq seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?Name: string * [<Optional; DefaultParameterValue ((null :> obj))>] ?ShowLegend: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?Opacity: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiOpacity: float seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?Text: 'c * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiText: 'c seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?MarkerColor: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?MarkerColorScale: Colorscale * [<Optional; DefaultParameterValue ((null :> obj))>] ?MarkerOutline: Line * [<Optional; DefaultParameterValue ((null :> obj))>] ?MarkerPatternShape: PatternShape * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiMarkerPatternShape: PatternShape seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?MarkerPattern: Pattern * [<Optional; DefaultParameterValue ((null :> obj))>] ?Marker: Marker * [<Optional; DefaultParameterValue ((null :> obj))>] ?Base: #IConvertible * [<Optional; DefaultParameterValue ((null :> obj))>] ?Width: 'e * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiWidth: 'e seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?TextPosition: TextPosition * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiTextPosition: TextPosition seq * [<Optional; DefaultParameterValue ((true :> obj))>] ?UseDefaults: bool -> GenericChart (requires 'b :> IConvertible and 'c :> IConvertible and 'e :> IConvertible) + 1 overload
static member BoxPlot: [<Optional; DefaultParameterValue ((null :> obj))>] ?X: 'a seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiX: 'a seq seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?Y: 'b seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiY: 'b seq seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?Name: string * [<Optional; DefaultParameterValue ((null :> obj))>] ?ShowLegend: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?Text: 'c * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiText: 'c seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?FillColor: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?MarkerColor: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?Marker: Marker * [<Optional; DefaultParameterValue ((null :> obj))>] ?Opacity: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?WhiskerWidth: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?BoxPoints: BoxPoints * [<Optional; DefaultParameterValue ((null :> obj))>] ?BoxMean: BoxMean * [<Optional; DefaultParameterValue ((null :> obj))>] ?Jitter: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?PointPos: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?Orientation: Orientation * [<Optional; DefaultParameterValue ((null :> obj))>] ?OutlineColor: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?OutlineWidth: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?Outline: Line * [<Optional; DefaultParameterValue ((null :> obj))>] ?AlignmentGroup: string * [<Optional; DefaultParameterValue ((null :> obj))>] ?OffsetGroup: string * [<Optional; DefaultParameterValue ((null :> obj))>] ?Notched: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?NotchWidth: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?QuartileMethod: QuartileMethod * [<Optional; DefaultParameterValue ((null :> obj))>] ?SizeMode: BoxSizeMode * [<Optional; DefaultParameterValue ((true :> obj))>] ?UseDefaults: bool -> GenericChart (requires 'a :> IConvertible and 'b :> IConvertible and 'c :> IConvertible) + 2 overloads
static member Bubble: x: #IConvertible seq * y: #IConvertible seq * sizes: int seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?Name: string * [<Optional; DefaultParameterValue ((null :> obj))>] ?ShowLegend: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?Opacity: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiOpacity: float seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?Text: 'c * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiText: 'c seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?TextPosition: TextPosition * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiTextPosition: TextPosition seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?MarkerColor: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?MarkerColorScale: Colorscale * [<Optional; DefaultParameterValue ((null :> obj))>] ?MarkerOutline: Line * [<Optional; DefaultParameterValue ((null :> obj))>] ?MarkerSymbol: MarkerSymbol * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiMarkerSymbol: MarkerSymbol seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?Marker: Marker * [<Optional; DefaultParameterValue ((null :> obj))>] ?LineColor: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?LineColorScale: Colorscale * [<Optional; DefaultParameterValue ((null :> obj))>] ?LineWidth: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?LineDash: DrawingStyle * [<Optional; DefaultParameterValue ((null :> obj))>] ?Line: Line * [<Optional; DefaultParameterValue ((null :> obj))>] ?AlignmentGroup: string * [<Optional; DefaultParameterValue ((null :> obj))>] ?OffsetGroup: string * [<Optional; DefaultParameterValue ((null :> obj))>] ?StackGroup: string * [<Optional; DefaultParameterValue ((null :> obj))>] ?Orientation: Orientation * [<Optional; DefaultParameterValue ((null :> obj))>] ?GroupNorm: GroupNorm * [<Optional; DefaultParameterValue ((false :> obj))>] ?UseWebGL: bool * [<Optional; DefaultParameterValue ((true :> obj))>] ?UseDefaults: bool -> GenericChart (requires 'c :> IConvertible) + 1 overload
static member Candlestick: ``open`` : #IConvertible seq * high: #IConvertible seq * low: #IConvertible seq * close: #IConvertible seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?X: 'e seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiX: 'e seq seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?Name: string * [<Optional; DefaultParameterValue ((null :> obj))>] ?ShowLegend: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?Opacity: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?Text: 'f * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiText: 'f seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?Line: Line * [<Optional; DefaultParameterValue ((null :> obj))>] ?IncreasingColor: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?Increasing: FinanceMarker * [<Optional; DefaultParameterValue ((null :> obj))>] ?DecreasingColor: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?Decreasing: FinanceMarker * [<Optional; DefaultParameterValue ((null :> obj))>] ?WhiskerWidth: float * [<Optional; DefaultParameterValue ((true :> obj))>] ?ShowXAxisRangeSlider: bool * [<Optional; DefaultParameterValue ((true :> obj))>] ?UseDefaults: bool -> GenericChart (requires 'e :> IConvertible and 'f :> IConvertible) + 2 overloads
static member Column: values: #IConvertible seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?Keys: 'b seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiKeys: 'b seq seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?Name: string * [<Optional; DefaultParameterValue ((null :> obj))>] ?ShowLegend: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?Opacity: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiOpacity: float seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?Text: 'c * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiText: 'c seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?MarkerColor: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?MarkerColorScale: Colorscale * [<Optional; DefaultParameterValue ((null :> obj))>] ?MarkerOutline: Line * [<Optional; DefaultParameterValue ((null :> obj))>] ?MarkerPatternShape: PatternShape * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiMarkerPatternShape: PatternShape seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?MarkerPattern: Pattern * [<Optional; DefaultParameterValue ((null :> obj))>] ?Marker: Marker * [<Optional; DefaultParameterValue ((null :> obj))>] ?Base: #IConvertible * [<Optional; DefaultParameterValue ((null :> obj))>] ?Width: 'e * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiWidth: 'e seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?TextPosition: TextPosition * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiTextPosition: TextPosition seq * [<Optional; DefaultParameterValue ((true :> obj))>] ?UseDefaults: bool -> GenericChart (requires 'b :> IConvertible and 'c :> IConvertible and 'e :> IConvertible) + 1 overload
static member Contour: zData: #('b seq) seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?Name: string * [<Optional; DefaultParameterValue ((null :> obj))>] ?ShowLegend: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?Opacity: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?X: 'c seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiX: 'c seq seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?Y: 'd seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiY: 'd seq seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?Text: 'e * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiText: 'e seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?ColorBar: ColorBar * [<Optional; DefaultParameterValue ((null :> obj))>] ?ColorScale: Colorscale * [<Optional; DefaultParameterValue ((null :> obj))>] ?ShowScale: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?ReverseScale: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?Transpose: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?ContourLinesColor: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?ContourLinesDash: DrawingStyle * [<Optional; DefaultParameterValue ((null :> obj))>] ?ContourLinesSmoothing: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?ContourLinesWidth: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?ContourLines: Line * [<Optional; DefaultParameterValue ((null :> obj))>] ?ShowContourLines: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?ContoursColoring: ContourColoring * [<Optional; DefaultParameterValue ((null :> obj))>] ?ContoursOperation: ConstraintOperation * [<Optional; DefaultParameterValue ((null :> obj))>] ?ContoursType: ContourType * [<Optional; DefaultParameterValue ((null :> obj))>] ?ShowContoursLabels: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?ContoursLabelFont: Font * [<Optional; DefaultParameterValue ((null :> obj))>] ?ContoursStart: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?ContoursEnd: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?Contours: Contours * [<Optional; DefaultParameterValue ((null :> obj))>] ?FillColor: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?NContours: int * [<Optional; DefaultParameterValue ((true :> obj))>] ?UseDefaults: bool -> GenericChart (requires 'b :> IConvertible and 'c :> IConvertible and 'd :> IConvertible and 'e :> IConvertible)
static member Funnel: x: #IConvertible seq * y: #IConvertible seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?Name: string * [<Optional; DefaultParameterValue ((null :> obj))>] ?ShowLegend: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?Opacity: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?Width: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?Offset: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?Text: 'c * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiText: 'c seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?TextPosition: TextPosition * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiTextPosition: TextPosition seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?Orientation: Orientation * [<Optional; DefaultParameterValue ((null :> obj))>] ?AlignmentGroup: string * [<Optional; DefaultParameterValue ((null :> obj))>] ?OffsetGroup: string * [<Optional; DefaultParameterValue ((null :> obj))>] ?MarkerColor: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?MarkerOutline: Line * [<Optional; DefaultParameterValue ((null :> obj))>] ?Marker: Marker * [<Optional; DefaultParameterValue ((null :> obj))>] ?TextInfo: TextInfo * [<Optional; DefaultParameterValue ((null :> obj))>] ?ConnectorLineColor: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?ConnectorLineStyle: DrawingStyle * [<Optional; DefaultParameterValue ((null :> obj))>] ?ConnectorFillColor: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?ConnectorLine: Line * [<Optional; DefaultParameterValue ((null :> obj))>] ?Connector: FunnelConnector * [<Optional; DefaultParameterValue ((null :> obj))>] ?InsideTextFont: Font * [<Optional; DefaultParameterValue ((null :> obj))>] ?OutsideTextFont: Font * [<Optional; DefaultParameterValue ((true :> obj))>] ?UseDefaults: bool -> GenericChart (requires 'c :> IConvertible)
static member Heatmap: zData: #('b seq) seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?X: 'c seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiX: 'c seq seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?Y: 'd seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiY: 'd seq seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?Name: string * [<Optional; DefaultParameterValue ((null :> obj))>] ?ShowLegend: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?Opacity: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?XGap: int * [<Optional; DefaultParameterValue ((null :> obj))>] ?YGap: int * [<Optional; DefaultParameterValue ((null :> obj))>] ?Text: 'e * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiText: 'e seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?ColorBar: ColorBar * [<Optional; DefaultParameterValue ((null :> obj))>] ?ColorScale: Colorscale * [<Optional; DefaultParameterValue ((null :> obj))>] ?ShowScale: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?ReverseScale: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?ZSmooth: SmoothAlg * [<Optional; DefaultParameterValue ((null :> obj))>] ?Transpose: bool * [<Optional; DefaultParameterValue ((false :> obj))>] ?UseWebGL: bool * [<Optional; DefaultParameterValue ((false :> obj))>] ?ReverseYAxis: bool * [<Optional; DefaultParameterValue ((true :> obj))>] ?UseDefaults: bool -> GenericChart (requires 'b :> IConvertible and 'c :> IConvertible and 'd :> IConvertible and 'e :> IConvertible) + 1 overload
...
static member Chart.Table: header: TraceObjects.TableHeader * cells: TraceObjects.TableCells * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?Name: string * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?ColumnOrder: int seq * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?ColumnWidth: float * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?MultiColumnWidth: float seq * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((true :> obj))>] ?UseDefaults: bool -> GenericChart
static member Chart.Table: headerValues: #('b seq) seq * cellsValues: #('d seq) seq * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((true :> obj))>] ?TransposeCells: bool * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?HeaderAlign: HorizontalAlign * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?HeaderMultiAlign: HorizontalAlign seq * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?HeaderFillColor: Color * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?HeaderHeight: int * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?HeaderOutlineColor: Color * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?HeaderOutlineWidth: float * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?HeaderOutlineMultiWidth: float seq * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?HeaderOutline: Line * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?CellsAlign: HorizontalAlign * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?CellsMultiAlign: HorizontalAlign seq * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?CellsFillColor: Color * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?CellsHeight: int * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?CellsOutlineColor: Color * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?CellsOutlineWidth: float * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?CellsOutlineMultiWidth: float seq * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?CellsOutline: Line * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?Name: string * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?ColumnOrder: int seq * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?ColumnWidth: float * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?MultiColumnWidth: float seq * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((true :> obj))>] ?UseDefaults: bool -> GenericChart (requires 'b :> System.IConvertible and 'd :> System.IConvertible)
static member Chart.Table: headerValues: #('b seq) seq * cellsValues: #('d seq) seq * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((true :> obj))>] ?TransposeCells: bool * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?HeaderAlign: HorizontalAlign * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?HeaderMultiAlign: HorizontalAlign seq * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?HeaderFillColor: Color * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?HeaderHeight: int * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?HeaderOutlineColor: Color * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?HeaderOutlineWidth: float * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?HeaderOutlineMultiWidth: float seq * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?HeaderOutline: Line * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?CellsAlign: HorizontalAlign * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?CellsMultiAlign: HorizontalAlign seq * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?CellsFillColor: Color * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?CellsHeight: int * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?CellsOutlineColor: Color * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?CellsOutlineWidth: float * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?CellsOutlineMultiWidth: float seq * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?CellsOutline: Line * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?Name: string * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?ColumnOrder: int seq * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?ColumnWidth: float * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?MultiColumnWidth: float seq * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((true :> obj))>] ?UseDefaults: bool -> GenericChart (requires 'b :> System.IConvertible and 'd :> System.IConvertible)
type GenericChart =
| Chart of data: Trace * layout: Layout * config: Config * displayOpts: DisplayOptions
| MultiChart of data: Trace list * layout: Layout * config: Config * displayOpts: DisplayOptions
static member addConfig: config: Config -> gChart: GenericChart -> GenericChart
static member addDisplayOptions: displayOpts: DisplayOptions -> gChart: GenericChart -> GenericChart
static member addLayout: layout: Layout -> gChart: GenericChart -> GenericChart
static member combine: gCharts: GenericChart seq -> GenericChart
static member countTrace: gChart: GenericChart -> int
static member existsTrace: predicate: (Trace -> bool) -> gChart: GenericChart -> bool
static member fromChartDTO: dto: ChartDTO -> GenericChart
static member fromFigure: fig: Figure -> GenericChart
static member getConfig: gChart: GenericChart -> Config
static member getDisplayOptions: gChart: GenericChart -> DisplayOptions
...
<summary> The central type that gets created by all Chart constructors is GenericChart, which itself represents either a single chart or a multi chart (as a Discriminate Union type). A GenericChart consists of four top level objects: Trace (multiple of those in the case of a MultiChart), Layout, Config, and DisplayOptions. - `Trace` is in principle the representation of a dataset on a chart, including for example the data itself, color and shape of the visualization, etc. - `Layout` is everything of the chart that is not dataset specific - e.g. the shape and style of axes, the chart title, etc. - `Config` is an object that configures high level properties of the chart like making all chart elements editable or the tool bar on top - `DisplayOptions` is an object that contains meta information about how the html document that contains the chart. </summary>
<summary> The central type that gets created by all Chart constructors is GenericChart, which itself represents either a single chart or a multi chart (as a Discriminate Union type). A GenericChart consists of four top level objects: Trace (multiple of those in the case of a MultiChart), Layout, Config, and DisplayOptions. - `Trace` is in principle the representation of a dataset on a chart, including for example the data itself, color and shape of the visualization, etc. - `Layout` is everything of the chart that is not dataset specific - e.g. the shape and style of axes, the chart title, etc. - `Config` is an object that configures high level properties of the chart like making all chart elements editable or the tool bar on top - `DisplayOptions` is an object that contains meta information about how the html document that contains the chart. </summary>
static member GenericChart.toChartHTML: gChart: GenericChart -> string
val table2: GenericChart
val header: string list
val rows: string list list
type HorizontalAlign =
| Left
| Center
| Right
member Convert: unit -> obj
override ToString: unit -> string
static member convert: (HorizontalAlign -> obj)
static member toString: (HorizontalAlign -> string)
union case HorizontalAlign.Center: HorizontalAlign
union case HorizontalAlign.Left: HorizontalAlign
union case HorizontalAlign.Right: HorizontalAlign
type Color =
override Equals: other: obj -> bool
override GetHashCode: unit -> int
static member fromARGB: a: int -> r: int -> g: int -> b: int -> Color
static member fromColorScaleValues: c: #IConvertible seq -> Color
static member fromColors: c: Color seq -> Color
static member fromHex: s: string -> Color
static member fromKeyword: c: ColorKeyword -> Color
static member fromRGB: r: int -> g: int -> b: int -> Color
static member fromString: c: string -> Color
member Value: obj
<summary> Plotly color can be a single color, a sequence of colors, or a sequence of numeric values referencing the color of the colorscale obj </summary>
<summary> Plotly color can be a single color, a sequence of colors, or a sequence of numeric values referencing the color of the colorscale obj </summary>
static member Color.fromString: c: string -> Color
static member Color.fromColors: c: Color seq -> Color
val table3: GenericChart
val header2: string list
val rowvalues: float list seq
module Seq
from Microsoft.FSharp.Collections
val sortBy: projection: ('T -> 'Key) -> source: 'T seq -> 'T seq (requires comparison)
val x: float list
val mapColor: min: float -> max: float -> value: float -> Color
val min: float
val max: float
val value: float
val proportion: int
Multiple items
val int: value: 'T -> int (requires member op_Explicit)
--------------------
type int = int32
--------------------
type int<'Measure> = int
val int: value: 'T -> int (requires member op_Explicit)
--------------------
type int = int32
--------------------
type int<'Measure> = int
static member Color.fromRGB: r: int -> g: int -> b: int -> Color
val cellcolor: Color
val map: mapping: ('T -> 'U) -> source: 'T seq -> 'U seq
val row: float list
val mapi: mapping: (int -> 'T -> 'U) -> source: 'T seq -> 'U seq
val index: int
val transpose: source: #('T seq) seq -> 'T seq seq
val table4: GenericChart
val sequence: string
module String
from Microsoft.FSharp.Core
val concat: sep: string -> strings: string seq -> string
val elementsPerRow: int
val headers: string seq
val x: int
val cells: string seq seq
val chunkBySize: chunkSize: int -> source: 'T seq -> 'T array seq
val i: int
val x: char array
val append: source1: 'T seq -> source2: 'T seq -> 'T seq
Multiple items
val string: value: 'T -> string
--------------------
type string = System.String
val string: value: 'T -> string
--------------------
type string = System.String
val cellcolors: Color
val row: string seq
val element: string
val x: Color seq
Multiple items
val seq: sequence: 'T seq -> 'T seq
--------------------
type 'T seq = System.Collections.Generic.IEnumerable<'T>
val seq: sequence: 'T seq -> 'T seq
--------------------
type 'T seq = System.Collections.Generic.IEnumerable<'T>
val line: Line
Multiple items
type Line = inherit DynamicObj new: unit -> Line static member init: [<Optional; DefaultParameterValue ((null :> obj))>] ?BackOff: BackOff * [<Optional; DefaultParameterValue ((null :> obj))>] ?AutoColorScale: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?CAuto: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?CMax: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?CMid: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?CMin: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?Color: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?ColorAxis: SubPlotId * [<Optional; DefaultParameterValue ((null :> obj))>] ?Colorscale: Colorscale * [<Optional; DefaultParameterValue ((null :> obj))>] ?ReverseScale: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?ShowScale: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?ColorBar: ColorBar * [<Optional; DefaultParameterValue ((null :> obj))>] ?Dash: DrawingStyle * [<Optional; DefaultParameterValue ((null :> obj))>] ?Shape: Shape * [<Optional; DefaultParameterValue ((null :> obj))>] ?Simplify: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?Smoothing: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?Width: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiWidth: float seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?OutlierColor: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?OutlierWidth: float -> Line static member style: [<Optional; DefaultParameterValue ((null :> obj))>] ?BackOff: BackOff * [<Optional; DefaultParameterValue ((null :> obj))>] ?AutoColorScale: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?CAuto: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?CMax: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?CMid: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?CMin: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?Color: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?ColorAxis: SubPlotId * [<Optional; DefaultParameterValue ((null :> obj))>] ?Colorscale: Colorscale * [<Optional; DefaultParameterValue ((null :> obj))>] ?ReverseScale: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?ShowScale: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?ColorBar: ColorBar * [<Optional; DefaultParameterValue ((null :> obj))>] ?Dash: DrawingStyle * [<Optional; DefaultParameterValue ((null :> obj))>] ?Shape: Shape * [<Optional; DefaultParameterValue ((null :> obj))>] ?Simplify: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?Smoothing: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?Width: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiWidth: float seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?OutlierColor: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?OutlierWidth: float -> (Line -> Line)
<summary> The line object determines the style of the line in various aspect of plots such as a line connecting datums, outline of layout objects, etc.. </summary>
--------------------
new: unit -> Line
type Line = inherit DynamicObj new: unit -> Line static member init: [<Optional; DefaultParameterValue ((null :> obj))>] ?BackOff: BackOff * [<Optional; DefaultParameterValue ((null :> obj))>] ?AutoColorScale: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?CAuto: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?CMax: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?CMid: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?CMin: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?Color: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?ColorAxis: SubPlotId * [<Optional; DefaultParameterValue ((null :> obj))>] ?Colorscale: Colorscale * [<Optional; DefaultParameterValue ((null :> obj))>] ?ReverseScale: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?ShowScale: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?ColorBar: ColorBar * [<Optional; DefaultParameterValue ((null :> obj))>] ?Dash: DrawingStyle * [<Optional; DefaultParameterValue ((null :> obj))>] ?Shape: Shape * [<Optional; DefaultParameterValue ((null :> obj))>] ?Simplify: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?Smoothing: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?Width: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiWidth: float seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?OutlierColor: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?OutlierWidth: float -> Line static member style: [<Optional; DefaultParameterValue ((null :> obj))>] ?BackOff: BackOff * [<Optional; DefaultParameterValue ((null :> obj))>] ?AutoColorScale: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?CAuto: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?CMax: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?CMid: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?CMin: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?Color: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?ColorAxis: SubPlotId * [<Optional; DefaultParameterValue ((null :> obj))>] ?Colorscale: Colorscale * [<Optional; DefaultParameterValue ((null :> obj))>] ?ReverseScale: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?ShowScale: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?ColorBar: ColorBar * [<Optional; DefaultParameterValue ((null :> obj))>] ?Dash: DrawingStyle * [<Optional; DefaultParameterValue ((null :> obj))>] ?Shape: Shape * [<Optional; DefaultParameterValue ((null :> obj))>] ?Simplify: bool * [<Optional; DefaultParameterValue ((null :> obj))>] ?Smoothing: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?Width: float * [<Optional; DefaultParameterValue ((null :> obj))>] ?MultiWidth: float seq * [<Optional; DefaultParameterValue ((null :> obj))>] ?OutlierColor: Color * [<Optional; DefaultParameterValue ((null :> obj))>] ?OutlierWidth: float -> (Line -> Line)
<summary> The line object determines the style of the line in various aspect of plots such as a line connecting datums, outline of layout objects, etc.. </summary>
--------------------
new: unit -> Line
static member Line.init: [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?BackOff: BackOff * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?AutoColorScale: bool * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?CAuto: bool * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?CMax: float * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?CMid: float * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?CMin: float * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?Color: Color * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?ColorAxis: SubPlotId * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?Colorscale: Colorscale * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?ReverseScale: bool * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?ShowScale: bool * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?ColorBar: ColorBar * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?Dash: DrawingStyle * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?Shape: Shape * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?Simplify: bool * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?Smoothing: float * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?Width: float * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?MultiWidth: float seq * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?OutlierColor: Color * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?OutlierWidth: float -> Line
val chartwidth: int
static member Chart.withSize: width: float * height: float -> (GenericChart -> GenericChart)
static member Chart.withSize: [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?Width: int * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?Height: int -> (GenericChart -> GenericChart)
static member Chart.withSize: [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?Width: int * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?Height: int -> (GenericChart -> GenericChart)
static member Chart.withTitle: title: Title -> (GenericChart -> GenericChart)
static member Chart.withTitle: title: string * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?TitleFont: Font -> (GenericChart -> GenericChart)
static member Chart.withTitle: title: string * [<System.Runtime.InteropServices.Optional; System.Runtime.InteropServices.DefaultParameterValue ((null :> obj))>] ?TitleFont: Font -> (GenericChart -> GenericChart)